Why do I do stuff like this?

[Sam Kennedy]

I've just spent around 1.5 hours making a program which generates a DNA sequence, names the amino acids it creates, generates the single letter code, mutates it, then compares it to the old one.

Here's an example with 10 amino acids:
ATGGTGAATAGTAGTGGTAATGAGGGTTAA
START-Valine-Asparagine-Serine-Serine-Glycine-Asparagine-Glutamic Acid-Glycine-STOP
SLC Code: MVNSSGNEG

Then I can mutate it by 25%:
ATGATGAGTAGGAGTAGTGATTGGGGTTAA
START-Valine-Asparagine-Serine-Serine-Glycine-Asparagine-Glutamic Acid-Glycine-STOP-START-START-Serine-Arginine-Serine-Serine-Aspartic Acid-Tryptophan-Glycine-STOP
SLC Code: MMSRSSDWG

I should really put some effort into my AS Levels or something

It is quite interesting to find what the actual protein they make is. (Those 2 are fictional, the second is broken).

 

[thomas]

That's nice

Thankfully I have a month off before I need to start programming again...got some pair work, making a car lift share selling website and a bit of database/java programming to complete (might have to do a little bit of that over Easter).

Now, do something useful...actually, I could send you my coursework sheet and you could have a go at it, maybe put my name on it and send it to me?

I'll be down the Pub when you're done

 

[dan_bo]

Glu-Fib?

 

[vernon]

I've just spent around 1.5 hours making a program which generates a DNA sequence, names the amino acids it creates, generates the single letter code, mutates it, then compares it to the old one.

I should really put some effort into my AS Levels or something

It is quite interesting to find what the actual protein they make is. (Those 2 are fictional, the second is broken).

You've got too much time on your hands. Have a play with Jmol, a molecule viewer and spend time creating visualisations of proteins suitable for deployment over the Internet.

 

[swee'pea99]

I have absolutely no idea what you're talking about, so I cannot answer your question. Perhaps you are a very sick puppy?

 

[Norm]

Errrmmmm... weather turned out nice again.

 

[Muddyfox]

This is the 1st post on this thread that i understand

Simon

 

[fossyant]

This is the 1st post on this thread that i understand

Simon

And that is the second...........

Odd balls.............

 

[rh100]

ATGGTGAATAGTAGTGGTAATGAGGGTTAA
START-Valine-Asparagine-Serine-Serine-Glycine-Asparagine-Glutamic Acid-Glycine-STOP
SLC Code: MVNSSGNEG

Then I can mutate it by 25%:
ATGATGAGTAGGAGTAGTGATTGGGGTTAA
START-Valine-Asparagine-Serine-Serine-Glycine-Asparagine-Glutamic Acid-Glycine-STOP-START-START-Serine-Arginine-Serine-Serine-Aspartic Acid-Tryptophan-Glycine-STOP
SLC Code: MMSRSSDWG

QUOTE]

so are those campag or shimano part numbers then?

 

[Fnaar]

See if you can re-design the human genome from scratch, and make the world a nicer place
Or just invent a gene that makes everyone want to cycle, and have good road sense etc

 

[Kestevan]

Sam,

You really, really need to get a girlfriend.....

 

[Sam Kennedy]

Sam,

You really, really need to get a girlfriend.....

It's alright I got a bike instead

 

[Sam Kennedy]

You've got too much time on your hands. Have a play with Jmol, a molecule viewer and spend time creating visualisations of proteins suitable for deployment over the Internet.

Would it sound sad if I told you I already tried that......

 

[vernon]

Nope.

What surprises me is that I've not seen any school/college based web sites that use Jmol effectively if at all.

There's got to be a market out there for some decent pages. I first dabbled with it ( or rather it's predecessor) in 1996 and included a couple interactive molecule pages in a school based web site that went on to win the high school category of Microsoft's Road Ahead Prize. I collected the prize personally from Bill Gates in Lisbon.

The ensuing acrimony over how the winnings should be spent in my school lead to a fourteen year gap before I build another web site other than ones to demonstrate the skills to pupils but that's another story.

 

[Hover Fly]

The ensuing acrimony over how the winnings should be spent in my school...

Ah, yes. The old big bag of toffees or cream cakes all round dilemma.